P C R

 
User#:Hit Counter
Bio 420/642
 Molecular Biology
Department of Biological Sciences, Lehman College

Search course content for:

E-mail Dr. Wurtzel

Home ] Schedule ] Accessories ] Internet ] Experiments ] Reports ] Results Checklist ] Grading Form ] Report Format ] Flow Chart ]
Laboratory instructor:

 

WB01501_.gif (476 bytes)Materials and recipes

Web resources:

(What is PCR?)

Introduction:

Here are is a common PCR reaction. You should think of possible controls (both positive and negative) you can perform along with the test reaction. Make a table. You should also consider varying some of the components (DNA template concentration, Mg++ concentration, etc) to see what works best. Be inventive. After you have performed the PCR and controls  you should analyze your results by gel electrophoresis on a 1% agarose gel.

 

We are going to use the plasmid, C71794, donated by Japanese organization, RGP as the DNA template for the PCR reaction. The C71794 is partial cDNA of rice phytoene synthase gene and was inserted between NotI and SacI at vector pBluescript SK(-) II. The sequence of insert is available at Genbank (accession number is C71794). The primers are oligonucleotides that were designed by Dr. Wurtzel's lab (#480(T3) and #481(T7)).  There sequences are as follows: 480 - 5' AATTAACCCTCACTAAAGGGA 3'; 481 - 5' GTAATACGACTCACTATAGGGC 3'.  T7 and T3 are very commonly primers at vector and used for sequencing. Here we can use them to amplify the insert and detect its length .

 

Add components in order on ice into a sterile PCR tube:

10X PCR Buffer 2.5 無
0.01 ug/ul DNA template(C71794) 1 無
Forward primer 1 無
Reverse Primer 1 無
25 mM dNTPS 2 無
50mM MgCl2 1 無
MilliQ water to 25 無(15.5)
TAQ polymerase 1.0 無

Set up a control tube without the template DNA by substituting it with sterile water.   Overlay with 10 無 mineral oil  (Please note that only certain type of therocyclers require overlay of mineral oil).

Thermocycle:

3 min, 94 oC
[30s, 94  oC; 30s, 58  oC; 30 s, 72  oC] repeated 30 times
10 min, 72  o C

The instructor will help you to program the thermocycler.

Electrophorese the reaction to analyze the products (1% agarose gel in 1xTAE).  Calculate the molecular weight of the product using the gel picture.

Back Up

 

Home Schedule Accessories Internet Experiments Reports Results Checklist Grading Form Report Format Flow Chart